Topic : Génome

Génome

Bonjour pouvez vous m'aider à corriger un petit exercice dont je ne suis pas sûre des réponses?

Sur la beta-hemoglobinopathie, on fait une PCR. 

La région amplifiée contient le début de la séquence codante de la bêta-globine normale dont la traduction en acides aminés donne :

MVHLTPEEKSAVTALWGK

Les résultats de séquencage obtenus sont les suivants :

Individu non atteint de b-hémoglobinopathie:   5'-ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAG-3'

Patient atteint : 5'-ATGGTGCATCTGACTCCTGTGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAG-3'

Pere ou mère du patient atteint : 5'-                        ATGGTGCATCTGACTCCTGA(ou T)GGAGAAG TCTGTGCTGCCGTTACTGCCCTGTGGGGCAAG-3'

Aucun des individus séquencés ne présente de délétion de grande taille dans le gène de la bêtaglobine. 

Vrai ou faux :

A- la séquence en acides aminés présentée peut constituer l'extrémité N-terminale de la bêta-globine (j'ai mis vrai)

B- le patient atteint de bêta hemoglobinopathie est homozygote pour la mutation (j'ai mis faux car ses deux parents ne sont pas atteints selon l'énoncé)

C- la mutation de la bêta-globine chez le patient transforme un acide glutamique en valine (j'ai mis vrai)

D- lorsqu'elle est présente à l'état homozygote, la mutation ponctuelle responsable de la maladie est une substitution d'une adenine en thymine sur le brin sens (j'ai mis faux car la nous avons les brins non sens et donc codants qui sont présentés dans l'énoncé)

E- lorsqu'elle est présente à l'état homozygote  la mutation ponctuelle responsable de la maladie est une substitution d'une thymine en adenine sur le brin sens (du coup j'ai mis vrai)

J'espère que vous pourrez m'aider !! ;) 

Tu connais quelqu'un qui peut répondre à cette question ? N'hésite pas à partager le lien de cette page par email ou via les réseaux sociaux.

0 Réponse

Continue ta visite en consultant les autres questions posées par les membres, ou pose une nouvelle question.

Rechercher
Rejoindre la communauté

Créez un compte gratuit pour recevoir des cours, QCM et des conseils pour réussir vos études !

eBooks gratuits

eBiologie met à disposition plusieurs eBooks contenant des séries de QCM (5 fascicules offerts pour chaque inscrit).

ebook

Réseaux sociaux